Single-nucleotide polymorphism markers in mitochondrial genomes for identifying <i>Varroa destructor</i>-resistant and -susceptible strains of <i>Apis mellifera</i> (Hymenoptera: Apidae)

Mitogenome sequences have a high potential for possessing single-nucleotide polymorphisms (SNPs) that can be used to identify different strains of an organism bred based on maternal lines. The European honey bee, <i>Apis mellifera ligustica</i> (Hymenoptera: Apidae), with a high-hygienic behaviour (HHB) against the external parasitic mite <i>Varroa destructor</i> has been bred for several years in Korea. To distinguish this strain from low-hygienic behaviour (LHB) strains, the complete mitogenome of the two strains were sequenced using next-generation sequencing techniques to detect SNPs. The two mitogenomes with lengths of 16,449 and 16,426 base pairs (bp) in the HHB and LHB strains, respectively, contained a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes, plus one non-coding region), exhibited similar-nucleotide compositions, and had an identical gene arrangement compared to other available <i>A. mellifera</i> mitogenomes. The major differences between the HHB and LHB strains included the length of the intergenic spacer sequences located at the <i>COIII</i> and <i>trnG</i> junction (88 vs. 70 bp) and <i>ND4</i> and <i>ND4L</i> junction (45 vs. 33 bp) and the presence or absence of a duplicated sequence block (CTTTTTTAAAAAAATAAAAA) in the A + T-rich region. Comparison of the mitogenome sequences from the two strains of <i>A. m. ligustica</i> revealed 23 SNPs in 11 protein-coding genes which were confirmed by sequencing of 10 randomly selected individuals from each strain, indicating the usefulness of these SNP markers for identifying the HHB strain of <i>A. m. ligustica</i>. Therefore, mitogenome sequences are a promising genome source for detecting SNP markers, particularly those in inbred female lines.