V1V2 16S bronciectiasis infections in ORBIT3 samples

DNA was extracted from sputum samples of bronchiectasis patients, most of which were infected with Pseudomonas aeruginosa under ORBIT3 trial of inhaled ciprofloxacin. The V1V2 region of 16S was amplifified and sequenced on an Illumina platform to estimate community composition. The primers used are given below: 28F ACACTCTTTCCCTACACGACGCTCTTCCGATC - TCCGAGTTTGATCMTGGCTCAG 338R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC - TTGCTGCCTCCCGTAGGAGT The '-' separates sequencing adapter part form locus specific primers