rCRUX Generated Teleo Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: teleo L1848/H1913 Gene: 12S Length of Target: 100 get_seeds_local() minimum length: 70 get_seeds_local() maximum length: 130 blast_seeds() minimum length: 40 blast_seeds() maximum length: 100 max_to_blast: 100 Forward Sequence (5'-3'): ACACCGCCCGTCACTCT Reverse Sequence (5'-3'): CTTCCGGTACACTTACCATG Reference: Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P. F., ... & Gaboriaud, C. (2016). Next‐generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology, 25(4), 929-942. https://doi.org/10.1111/mec.13428 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.